International Commission for the Taxonomy of Fungi (ICTF)
International Union of Microbiological Societies (IUMS, Mycology Division)
Login

Methods

Methods of molecular identifications and lab. protocols

Posted by Mette Lübeck on 2004-10-04

table of UP-PCR primers

0.3-1 5?CGAGAACGACGGTTCT (Bulat and Mironenko 1992, Bulat et al. 1994, Cumagun et al. 2000, Naumov et al. 2000, 2001, Naumova et al. 2001a, 2001b, Tokareva et al. 2001, Tyson et al. 2002) 0.3-2 5?TGAGGACAACGGTTCC (Bulat et al. 1992, Yli-Mattila et al. 1997, Paavanen-Huhtala et al. 2000) 3-1 5?TAAGGTGGCGGCCAGT (Bulat and Mironenko 1992) 3-2 5?TAAGGGCGGTGCCAGT (Bulat and Mironenko 1992, Bulat et al. 1994, 2000, Lübeck et al. 1998a, Cumagun et al. 2000, Jensen et al. 2001, Lübeck and Poulsen 2001, Mikkelsen et al. 2001, Nielsen et al. 2001, Tyson et al. 2002) AA2M2 5?CTGCGACCCAGAGCGG (Yli-Mattila et al. 1997, Lübeck et al. 1998a, 1998b, Bulat et al. 2000, Cumagun et al. 2000, Mironenko et al. 2000, Bulat et al. 1992, Yli-Mattila et al. 1997, Paavanen-Huhtala et al. 2000, Lübeck and Poulsen 2001, Tyson et al. 2002) AS4 5?TGTGGGCGCTCGACAC (Lübeck et al. 1998a, 1998b, Bulat et al. 2000, Cumagun et al. 2000, Jensen et al. 2001, Nielsen et al. 2001, Tyson et al. 2002) AS15 5?GGCTAAGCGGTCGTTAC (Bulat et al. 1994, 2000, Lübeck et al. 1998a, Cumagun et al. 2000, Jensen et al. 2001, Tyson et al. 2002) AS15inv 5?CATTGCTGGCGAATCGG (Lübeck et al. 1998a, Bulat et al. 2000, Cumagun et al. 2000, Lübeck and Poulsen 2001, Nielsen et al. 2001, Tyson et al. 2002) L15 5?GAGGGTGGCGGTTCT (Tyson et al. 2002) L15/AS19 5?GAGGGTGGCGGCTAG (Lübeck et al. 1998a, 1998b,1999, Cumagun et al. 2000, Mironenko et al. 2000, Lübeck and Poulsen 2001, Naumov et al. 2001, Tyson et al. 2002) L21 5?GGATCCGAGGGTGGCGGTTCT (Naumov et al. 1997, Lübeck et al. 1998a, 1998b, Bulat et al. 2000, Cumagun et al. 2000, Jensen et al. 2001, Lübeck and Poulsen 2001, Mikkelsen et al. 2001, Nielsen et al. 2001, Nielsen and Yohalem 2001, Tyson et al. 2002) L45 5?GTAAAACGACGGCCAGT (Bulat et al. 1994, 1998, Naumov et al. 1997, 2001, Lübeck et al. 1999, 2000, Cumagun et al. 2000, Lübeck and Poulsen 2001, Naumova et al. 2001b, Nielsen and Yohalem 2001, Tokareva et al. 2001, Lübeck and Jensen 2002, Tyson et al. 2002) HE45 5?GTAAAACGAGGCCAGT (Yli-Mattila et al. 1997)

posted by Mette Lübeck on 04 Oct, 2004

Copyright: Irina Druzhinina & Alexey Kopchinskiy 2004 - 2008